 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| circTP63 | |||
| Gene | TP63 | Organism | Human |
| Genome Locus | Build | hg19 | |
| Disease | Lung Squamous Cell Carcinoma | ICD-10 | Malignant neoplasm of bronchus and lung (C34) |
| DBLink | PMID | 31324812 | |
| Experimental Method | |||
| Sample Type | Tissue and cell lines | Comparison | 5 paired samples of LUSC |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward GCCCTCACTCCTACAACCATT ReverseTTGTGTGCTGAGGAAGGTACT | Statistics | Fold Change : Upregulated pvalue : <0.05 |
| Citation | |||
| Cheng, Z, Yu, C, Cui, S, Wang, H, Jin, H, Wang, C, Li, B, Qin, M, Yang, C, He, J, Zuo, Q, Wang, S, Liu, J, Ye, W, Lv, Y, Zhao, F, Yao, M, Jiang, L, Qin, W (2019). circTP63 functions as a ceRNA to promote lung squamous cell carcinoma progression by upregulating FOXM1. Nat Commun, 10, 1:3200. | |||